3 sequences Search Results


95
Chem Impex International c57bl 6j background apoe
C57bl 6j Background Apoe, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c57bl 6j background apoe/product/Chem Impex International
Average 95 stars, based on 1 article reviews
c57bl 6j background apoe - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

92
Toronto Research Chemicals glutathione ammonium salt d5 gsh d5
Glutathione Ammonium Salt D5 Gsh D5, supplied by Toronto Research Chemicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glutathione ammonium salt d5 gsh d5/product/Toronto Research Chemicals
Average 92 stars, based on 1 article reviews
glutathione ammonium salt d5 gsh d5 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

95
Chem Impex International trifluoroacetic acid tfa
Trifluoroacetic Acid Tfa, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trifluoroacetic acid tfa/product/Chem Impex International
Average 95 stars, based on 1 article reviews
trifluoroacetic acid tfa - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

95
Chem Impex International n methylmorpholine
N Methylmorpholine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n methylmorpholine/product/Chem Impex International
Average 95 stars, based on 1 article reviews
n methylmorpholine - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

95
Chem Impex International triethylamine
Triethylamine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/triethylamine/product/Chem Impex International
Average 95 stars, based on 1 article reviews
triethylamine - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

95
Chem Impex International 34860 acetonitrile acs grade
34860 Acetonitrile Acs Grade, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/34860 acetonitrile acs grade/product/Chem Impex International
Average 95 stars, based on 1 article reviews
34860 acetonitrile acs grade - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

90
Boster Bio mcl 1
Mcl 1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mcl 1/product/Boster Bio
Average 90 stars, based on 1 article reviews
mcl 1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

95
Chem Impex International l threonine t butyl ester
L Threonine T Butyl Ester, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/l threonine t butyl ester/product/Chem Impex International
Average 95 stars, based on 1 article reviews
l threonine t butyl ester - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

90
Promega consensus sequence 5′-agttgaggggactttcccaggc-3′
Consensus Sequence 5′ Agttgaggggactttcccaggc 3′, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/consensus sequence 5′-agttgaggggactttcccaggc-3′/product/Promega
Average 90 stars, based on 1 article reviews
consensus sequence 5′-agttgaggggactttcccaggc-3′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TriLink complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac)
Complementary Phosphorothioate Oligonucleotide (Codn, 5′ To 3′ Sequence = Tag Tgt Tga Cga Agg Gac), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac)/product/TriLink
Average 90 stars, based on 1 article reviews
complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Jerini Inc peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine
Peptides With The Sequence Of Bovine Pgis And Inserted 3 Nitrotyrosine, supplied by Jerini Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine/product/Jerini Inc
Average 90 stars, based on 1 article reviews
peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)
Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results