95
|
Chem Impex International
c57bl 6j background apoe C57bl 6j Background Apoe, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c57bl 6j background apoe/product/Chem Impex International Average 95 stars, based on 1 article reviews
c57bl 6j background apoe - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
92
|
Toronto Research Chemicals
glutathione ammonium salt d5 gsh d5 Glutathione Ammonium Salt D5 Gsh D5, supplied by Toronto Research Chemicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glutathione ammonium salt d5 gsh d5/product/Toronto Research Chemicals Average 92 stars, based on 1 article reviews
glutathione ammonium salt d5 gsh d5 - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
trifluoroacetic acid tfa Trifluoroacetic Acid Tfa, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trifluoroacetic acid tfa/product/Chem Impex International Average 95 stars, based on 1 article reviews
trifluoroacetic acid tfa - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
n methylmorpholine N Methylmorpholine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n methylmorpholine/product/Chem Impex International Average 95 stars, based on 1 article reviews
n methylmorpholine - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
triethylamine Triethylamine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/triethylamine/product/Chem Impex International Average 95 stars, based on 1 article reviews
triethylamine - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
34860 acetonitrile acs grade 34860 Acetonitrile Acs Grade, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/34860 acetonitrile acs grade/product/Chem Impex International Average 95 stars, based on 1 article reviews
34860 acetonitrile acs grade - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
90
|
Boster Bio
mcl 1 Mcl 1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mcl 1/product/Boster Bio Average 90 stars, based on 1 article reviews
mcl 1 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
l threonine t butyl ester L Threonine T Butyl Ester, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/l threonine t butyl ester/product/Chem Impex International Average 95 stars, based on 1 article reviews
l threonine t butyl ester - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
90
|
Promega
consensus sequence 5′-agttgaggggactttcccaggc-3′ Consensus Sequence 5′ Agttgaggggactttcccaggc 3′, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/consensus sequence 5′-agttgaggggactttcccaggc-3′/product/Promega Average 90 stars, based on 1 article reviews
consensus sequence 5′-agttgaggggactttcccaggc-3′ - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TriLink
complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac) Complementary Phosphorothioate Oligonucleotide (Codn, 5′ To 3′ Sequence = Tag Tgt Tga Cga Agg Gac), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac)/product/TriLink Average 90 stars, based on 1 article reviews
complementary phosphorothioate oligonucleotide (codn, 5′ to 3′ sequence = tag-tgt-tga-cga-agg-gac) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Jerini Inc
peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine Peptides With The Sequence Of Bovine Pgis And Inserted 3 Nitrotyrosine, supplied by Jerini Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine/product/Jerini Inc Average 90 stars, based on 1 article reviews
peptides with the sequence of bovine pgis and inserted 3-nitrotyrosine - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)/product/GenScript corporation Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |